EST details — SGN-E379497

Search information 
Request: 379497Match: SGN-E379497
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168419Clone name: TUS-3-B1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168419 [TUS-3-B1] Trace: SGN-T798 EST: SGN-E378864 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379497Length: 518 bp (791 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E379497 [] (trimmed) GAGATGGGGAGAGTGGTTTGCTTTTGTTTGAGCAGATGAGAAAACTTAGACGGTTGGAGCCCAATGGGGACACTTTTTCCGTGGTGCTTTCAGCC
TGTGCTAGTAAGGGGTATGTGAAAGAAGGTTTTACGTATTTTGAGCTAATGAAGAATGAATATGGCATTGTTCCTGGAGTTGAGCATTACTTAGG
GATCGCTGATGTTTTGGGAAAATCTGGGCATTTGAATGAATTGCTAGAGTTTATTGAAGACATGCCTATTGAGCCTACAAAAGTAGTATGGGAGG
CCGTGATAAATTTTGCACGAATTCATGGGGATATTGAACTTGAAGATCGAACGGAGGAGCTGCTCATTATGTTAGATTCTTCCAGAAATATGGCT
GATAAGCCGGTTGCACCATTTCAGAAAAGGCATTCTGAGTTTAATATGCTTGAGGGTAAAGACAGAGTTAATGAGTTCAAGAGCACAATTCCACA
TAGGGCAGATGCATATGAAAAATTGAAAGGCTTAAGCGGGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379497] SGN-U581772 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T254 [Download] [View] Facility Assigned ID: 228_B01_TUS03B1.T3_011.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5