| SGN ID: SGN-C56606 | Clone name: cLEL-2-F16 |  | Order Clone |
|
| Library Name: cLEL | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E38155 | Length: 255 bp (called/trimmed by facility)
|
| Status: Legacy Chimera not assessed | Direction: 3' [See links to 5' reads above] |
>SGN-E38155 [] (called/trimmed by facility)
TGGTNNTCTAGGAGGGGNTGATTGCATTTCGCCGCTGAATAGCAGTAGATCGACCGCCTGCAGGTCGACACTAGTCCATCCAAAGCTTCTGAAAT
CACCGGAAATGGGAGAGTCACCATGAGGAAGACTGCTACCAAGGCCAAGCCAGCCTCCTCTGGTAGCCCATGGTACGGTCCTGACCGTGTTAAGT
ACTTGGGACCATTCTCTGGGGAATCCCCAAGCTACTTGACCGGTGAGTTTCCTGGTGATTACGGA
[BLAST] [AA Translate]
| SGN-ID: SGN-T21179 [Download] [View] |
Facility Assigned ID: tomato020432.t3
|
| Submitter: Koni |
Sequencing Facility: Novartis |
Funding Organization: National Science Foundation
