EST details — SGN-E389990

Search information 
Request: 389990Match: SGN-E389990
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168835Clone name: TUS-4-C9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E389990Length: 744 bp (842 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E389990 [] (trimmed) CCGAGCGAGCGGGAATTTTCTCTCTCCATGCGGAGCTGAGAGAAAATCAAAAGCAAATCTTACCTCCATTATGATTTCTTCCTCCTTTTTTGCTG
TCAACAAAATCTATGGTTTCTGCCGTGGAGTTTGAAGAAAGTTTCCTCATCTCTGTTGTCTGTTTCTTCCAGTTCCCTCAAGTAGTAGAAGAAGA
TCACCATGGATTCGGTATGAAATCTTGATGAAAAAATTGGTCTGCTTATGCAGTGCAAACCCTTGTCCGAGCAGGCGATTTTTACATAGGATTCC
CCATCCTCCTCTGAGAAAAGAAAGCAAAAACAGAACAAATCACTTTTTTCCAGTAAAATAGGATTTGGAGAGCTTTCACGATCGTTCACATGAAT
TTCAGCAGGCCAGAAGGTAAGAGGACTGTGCGAGAAAGCCAACGAGATTCTAGTGCAAGAGAGTAATGTGCAGCCTGTGATAAGCCCTGTGACGA
TATGTGGTGATATTCATGGGCAGATCCATGATCTTGCTGAGCTTTTTCGAATTGGTGGGAAGTGTCCTGACACTAATTATTTATTCATGGGAGAT
TATGTGGATCGTGGATACTATTCTGTCGAAACAGTCTCGCTTTTGGTGGCTCTCAAAGTTCGCTATCCCCAACGAATTACTATCCTAAGGTGAAA
TCATGAGAGTCGTCAGATTACTCAGGTTTATGGGTTTTATGATGAATGCCTACGAAAATATGGTAATGCCGATGTGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E389990] SGN-U587481 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191316 [Download] [View] Facility Assigned ID: TUS04-C9.T3
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0151 Quality Trim Threshold: 14.5