EST details — SGN-E390146

Search information 
Request: 390146Match: SGN-E390146
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183053Clone name: TUS-41-C19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183053 is on microarray TOM1 spot ID 1-1-6.3.3.12 [Order] [Tomato Microarray Database]
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C17799 [cLED-20-M9] Trace: SGN-T53803 EST: SGN-E236286 Direction: 5' Facility: TIGR
Clone: SGN-C183053 [TUS-41-C19] Trace: SGN-T191473 EST: SGN-E390147 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390146Length: 469 bp (875 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390146 [] (trimmed) AAGTTGAACTTGAAAATCTAAAAATTAGGAATGTATAGAACAAAATATAAAATCTTAAAAGCTAGTCTTTCTTAGGTTCACATAGCAGTTACTTC
CAAAAGTTAAAACATAAATCAAAATTATCCCATTACATCATTTAACTGAAGGGAGATGCAAATCAAAAAGCTCTAATGCCATATGTCTTCTACCA
GCACCAAATGTAGAGGTCCTCGTAGAAACTCGTATTCAAGATTTTTAACGGTACTTGATGAAGCCAATTTCCTTGGCATTGCTGCGGAAGCACTG
TCTGCAACACATGAGTCCATACTTTCTAATAATTGCATGAGGATTACCACACACACGGCATGTGCGAGAGCCAGGGCCGTAGTTCTTTGGGTGAG
CGTTCCAGATGTTAGAGTGACCCATCTTCACAGAAAAGCGAGGCTGCGCGATGTGTTTGCAAGAAAACCCTACTTTTGCAGAACTCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390146] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191472 [Download][View] Facility Assigned ID: FA0AAD29AB10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0014 Quality Trim Threshold: 12.5