EST details — SGN-E390205

Search information 
Request: 390205Match: SGN-E390205
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182304Clone name: TUS-39-D14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182304 is on microarray TOM1 spot ID 1-1-3.4.8.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15601 [cLED-13-G24] Trace: SGN-T51666 EST: SGN-E236388 Direction: 5' Facility: TIGR
Clone: SGN-C182304 [TUS-39-D14] Trace: SGN-T191532 EST: SGN-E390206 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390205Length: 447 bp (888 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390205 [] (trimmed) TAGGGGTTTATTATAGAAGGTTCAAACATACTTATAGCAGTAATTTTTTTTCCTAGCCAGGAAAAGGCATACACCTGCTGTTGCACTAAAATCAA
ACAAGCCACATAATCCAGTTCCAATAACAATTTAACAACATAGATAGATGAGCCTTATGCTGAAGCAGCAGCTTCTTCCAGCAACTGTTTCACCT
TGGTGATGTAGTCGTTCATGGCTTCATCGGTGGATTTTCCTTCAACAGCCTTCCATGCATCCCACTTTGCTCTGTCTCTCATGTTGAACATGCCA
GGACGGCTTGTGTTGACATCGCCAACGGTGGCTTGCTTGTAAAGTCCGTAAAGAATAAGCTTGTTCTCATTGGTGGTACTCTCAGGCAATGTCTT
AGCTTTCTCAGCATGTGCTTCAAATTCCTCCTTCAAAGCCATGATCTGATCTGGTTAGCTTGATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390205] SGN-U579768 Tomato 200607 Build 2 106 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191531 [Download][View] Facility Assigned ID: FA0AAD27DB07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0037 Quality Trim Threshold: 12.5