EST details — SGN-E390219

Search information 
Request: 390219Match: SGN-E390219
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182438Clone name: TUS-39-J4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182438 is on microarray TOM1 spot ID 1-1-5.2.8.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48278 [cLEI-3-P5] Trace: SGN-T79977 EST: SGN-E266289 Direction: 5' Facility: TIGR
Clone: SGN-C182438 [TUS-39-J4] Trace: SGN-T191769 EST: SGN-E390443 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390219Length: 496 bp (886 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E390219 [] (trimmed) CAGCCTGCTTCTGCGCCTAACTGCAGAATACACCGTTTTCGGCAGGAGAGCAATTCCCCCTACAAACAAAGTCATCATGCCTGCACTTGTTGTAA
CTGAAGAAACAATGGCCTCCGAGCTATCCAAGAAAAAAATGAAGAAGACACCCAAAACTGATATTGAAACTCCTACTGATAAGAAAACCAAAGAG
AAAAAGTCAAAAAAATCCAAGATTGAGTCTGGGTCTGATTCAGAGGACGCTAAAAGGAGTAAAAAAAAAAAAAAAAAAACTCGAGCTGCTTACCA
GCGAAAATCAACCTCTGCTGGTCTGAAGGAATTCCCTCCTTGTCCTGGATCTTAGCCTTAACATTATCAATGGTGTCGGAGCTTTCCACCTCCAA
AGTGATGGTCTTTCCGGTGAGGGTCTTAACAAAAATCTGCATACCACCACGGAGACGGAGGACAAGATGGAGGGTAGACTCCTTCTGGATGTTGT
AGTCAGCCAGGGTGCGACCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390219] SGN-U577265 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191545 [Download][View] Facility Assigned ID: FA0AAD27DE02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5