EST details — SGN-E390320

Search information 
Request: 390320Match: SGN-E390320
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173977Clone name: TUS-17-I15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173977 is on microarray TOM1 spot ID 1-1-2.1.17.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6498 [cLEC-35-J5] Trace: SGN-T30867 EST: SGN-E210519 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390320Length: 246 bp (901 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390320 [] (trimmed) ACATTGTATATTAATATAGATCATTAGTAAATGCTTTAAAAGCCATATACTCCTAAATAATTCATCATATCATAAACAATAATTATGAATTAATT
AACAAACTCCCATAGTCTTACTTCTTCTTTTTATCAGCAACAAACTTACTTCCATGCTTCCGTAACCTGGAACTCCCATTCTCTATCCGTTTTAA
GAAGTGCCACGCTGTCGATACCGCTCGCCGCGGCCGCCTCCTCGGCTGGTGCCGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390320] SGN-U581376 Tomato 200607 Build 2 81 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191646 [Download][View] Facility Assigned ID: FA0AAD5AE08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0266 Quality Trim Threshold: 12.5