EST details — SGN-E390419

Search information 
Request: 390419Match: SGN-E390419
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183046Clone name: TUS-41-C12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183046 is on microarray TOM1 spot ID 1-1-5.3.3.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28092 [cLEF-46-I22] Trace: SGN-T61707 EST: SGN-E247296 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390419Length: 496 bp (844 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E390419 [] (trimmed) CAGCCTGCTTCTGCGCCTAACTGCAGAATACACCGTTTTCGGCAGGAGAGCAATTCCCCCTACAAACAAAGTCATCATGCCTGCACTTGTTGTAA
CTGAAGAAACAATGGCCTCCGAGCTATCCAAGAAAAAAATGAAGAAGACACCCAAAACTGATATTGAAACTCCTACTGATAAGAAAACCAAAGAG
AAAAAGTCAAAAAAATCCAAGATTGAGTCTGGGTCTGATTCAGAGGACGCTAAAAGGAGTAAAAAAAAAAAAAAAAAAACTCGAGCTGCTTACCA
GCGAAAATCAACCTCTGCTGGTCTGAAGGAATTCCCTCCTTGTCCTGGATCTTAGCCTTAACATTATCAATGGTGTCGGAGCTTTCCACCTCCAA
AGTGATGGTCTTTCCGGTGAGGGTCTTAACAAAAATCTGCATACCACCACGGAGACGGAGGACAAGATGGAGGGTAGACTCCTTCTGGATGTTGT
AGTCAGCCAGGGTGCGACCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390419] SGN-U577265 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191745 [Download][View] Facility Assigned ID: FA0AAD29BB06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0031 Quality Trim Threshold: 12.5