EST details — SGN-E390467

Search information 
Request: 390467Match: SGN-E390467
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182665Clone name: TUS-40-C15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182665 is on microarray TOM1 spot ID 1-1-2.3.5.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C117617 [cTOA-8-O4] Trace: SGN-T125055 EST: SGN-E312866 Direction: 5' Facility: TIGR
Clone: SGN-C182665 [TUS-40-C15] Trace: SGN-T197488 EST: SGN-E396162 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390467Length: 664 bp (896 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390467 [] (trimmed) AATAAAGTTTGGATACGCTATTTATTCATTCGAACTAATAAAACCACAAATGTTCTTCCAAACCAATCAACCCCTAAATTCACTTTACTTGATAC
TAACAAATGTGTATCAGTAGTATTACAAGTCAGAAACAAGCATGAAAACAAAAAACTATATTGAAAGTAAGATGCTATGAGATCAGAAACAAGAA
GGCGATCAAATCGCGCAGAGTAACCCATAGAAACAGCCAATTTGCAAGATTGTGAAAGTATCATCTCTATTTGTTACGTTTTTTAGCCTGCTTGC
CTTGACCCTTCTTAGGAGGTCCCTTTCCACGACGTCTAAGCATTTCAAGCTTGCTCAGGCGCTCTTGCTCTTGACGTGCCATCACAAGAGGATCA
TCTTTCATGATATCATGTGGGTACCATTGTGAAACCTTCTCACCGATGAGCTTCTTGCGTAAAACCTTGTGGGATGATCTCTGCCCGGTTGGATT
AAGCACATGACCAAATATCCTGGCCCTTGCTTCAGCCAACCCTTCAATGGCTGCAGCAGCTACCACATTCTTTAGTCTCCCAAAGTTCATTTCTT
GGTTACGAAAGCAGCTCAGTACACGGATTTCTCTGCACAAAGAATCACAGTCTCAAGACAGACACATTAAACTAAGTCGCTATTAGTATATCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390467] SGN-U593780 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191793 [Download][View] Facility Assigned ID: FA0AAD28AB08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5