EST details — SGN-E390531
Search information |
Request: 390531 | Match: SGN-E390531 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C182745 | Clone name: TUS-40-F23 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C182745 is on microarray TOM1 spot ID 1-1-2.2.5.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C132309 [cTOD-2-E16] | Trace: SGN-T141988 | EST: SGN-E329374 | Direction: 5' | Facility: TIGR |
Sequence |
Sequence Id: SGN-E390531 | Length: 105 bp (908 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E390531 [] (trimmed)
GAACAGGAATAAAGATAGTTGATATAAGTATACAGAAGCATCAAATTCTCATATATTAGTGTAGAAAATCCAATTCTCATAGAACAACAAAAAAG
AAAAAGTGGC
AAAAAGTGGC
Unigenes |
Current Unigene builds | |||||
[SGN-E390531] | SGN-U581096 | Tomato 200607 | Build 2 | 19 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T191857 [Download][View] | Facility Assigned ID: FA0AAD28CC12RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.884 | Expected Error Rate: 0.0084 | Quality Trim Threshold: 14.5 |