EST details — SGN-E390572

Search information 
Request: 390572Match: SGN-E390572
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184353Clone name: TUS-44-I23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184353 is on microarray TOM1 spot ID 1-1-2.1.16.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15457 [cLED-11-P23] Trace: SGN-T51396 EST: SGN-E235386 Direction: 5' Facility: TIGR
Clone: SGN-C184353 [TUS-44-I23] Trace: SGN-T191899 EST: SGN-E390573 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390572Length: 496 bp (842 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390572 [] (trimmed) AAATTATTCTTTGTTTCCTGTATAAAATCATATATCAGTAGAATCTCTTTATTCACTTATCTAAGCTTTAGAAGTTTAGTCCAAATTCGAAGTTT
AAACTAGCTTCAACAACATTGACAGGAATGCAAGTAACATGAAATTCGATAAAAGGCATAAATACTTCAATTACAAATCAAGTTTACAAAATATT
AGCTACTATGAAATTTTATCCTCTTCTTATACACTGAGTTTGTCCATTTCCCTTCTTAGGGCATTAGCCCTCACCAAACTTCCAATGGTATTCGC
AGGAAGCTTCAAGTCTTCGATGGGGTTTCCTGGTGCAACTTTCTTGTAGAAATAGCTGTCGAATGTCATCTTCTGCACATACTCATCAGCGCACA
TCTCCACGAAAGCTTCTCTTGCTGGATTCGACCTGTAAAATACCTTCTGCAAGATATCAAGCACCTTGTAGGGGGGGGGGTAAGTCATGTCCCAT
TTCGCCAAGTACTTCCTCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390572] SGN-U564570 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191898 [Download][View] Facility Assigned ID: FA0AAD32AE12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5