EST details — SGN-E390649

Search information 
Request: 390649Match: SGN-E390649
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185630Clone name: TUS-47-O4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185630 is on microarray TOM1 spot ID 1-1-5.3.9.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22251 [cLED-37-F8] Trace: SGN-T58066 EST: SGN-E242245 Direction: 5' Facility: TIGR
Clone: SGN-C185630 [TUS-47-O4] Trace: SGN-T192210 EST: SGN-E390884 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390649Length: 630 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E390649 [] (trimmed) CTGAGAACTAAGTCGAGAGATCGTCGGCGATAGAGAGTAGGAGAAAGGAATTTGAAAGAAAAATGGCGTCGAACCAAGTGAGGGCATCCCACATA
CTCATCAAACACGAAGGATCTAGACGTAAATCTTCATGGAAAGATCCAGAAGGTCGCATCATCTGTAACACCACCAGAGACGCCGCCGCTTCCCA
GCTCAAATCCTTTCGCGATGACATCATCTCCGGCAAGTCCAAGTTCGAAGATGTTGCTTCTCGCTTCTCTGATTGCAGCTCTGCCAAACGCGGCG
GCGATCTCGGTCCATTTGGTCGAGGGCAGATGCAGAAACCTTTTGAAGTTGCAACCTATGCACTGGAGGTTGGTGAGATCAGCGACATCATTGAT
ACTGACAGTGGTGCTCACATAATTCTGAGAACCGGTTAACATTGGTGGAGAGAGTATCTAAAGATTCAAGAGCAATTGCAAGTTGTAACGTTTTT
TTAATTTTTATTTTGGTGTCTCAAAGACTACCCAGGTTTGTTTCGTTTTTTATTTTCACCACGTTTGTGATAAATTTCGATTGTATTATCAGTCA
GCTACAACTCCAGATGCCTGATGTTTATAGACGTTTTAATCCATGTGTTTAAAGTTTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390649] SGN-U583469 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T191975 [Download][View] Facility Assigned ID: FA0AAD35BH02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0010 Quality Trim Threshold: 12.5