EST details — SGN-E390812

Search information 
Request: 390812Match: SGN-E390812
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184429Clone name: TUS-44-M3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184429 is on microarray TOM1 spot ID 1-1-6.1.16.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15853 [cLED-14-D15] Trace: SGN-T52143 EST: SGN-E233789 Direction: 5' Facility: TIGR
Clone: SGN-C184429 [TUS-44-M3] Trace: SGN-T191908 EST: SGN-E390582 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390812Length: 511 bp (871 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390812 [] (trimmed) AGGATAAGAAATAGGGATAATCTATTTCTCTTATTCAGATAATTAGTAATTACACATAACACACAACTTTGATGCCCACATTATAATGATTAGCA
TGTCATTATATAAGTGTGCATCCTTTTATTTCATACATTAATTACTTAATTTTGGGCAATCCAGAAGATGGACAAGTCTAGAGTCACATTACAGG
GTACATATTTGCCTTGGGTTCATCACTCTCTCCTTCACATACAAACTTTCCATCTTTACCAAAATAATATCAACCCTTGTACCCTGTGCAACATG
TGGTACATCCGGTGGGATAAATTAACGATTTTCCTTGTGAACGGGGACATCTTGAATAGGCAATATTTGGATCACAATTAAAGGTGCAAGCATTT
GGCCTTTTTGGATCAGATTCTCCTTCACAAATAAATTTTCCGAAAGAATTATAATAATTACAACCCTTATAGGCGGAGCAACAATTGATGCATAT
GGGATTTAGCGGACTTCCTTCTGAACGTGGGCATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390812] SGN-U578366 Tomato 200607 Build 2 209 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192138 [Download][View] Facility Assigned ID: FA0AAD32AG02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5