EST details — SGN-E390836

Search information 
Request: 390836Match: SGN-E390836
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185304Clone name: TUS-47-A14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185304 is on microarray TOM1 spot ID 1-1-3.1.9.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72988 [cLER-2-M4] Trace: SGN-T92492 EST: SGN-E278774 Direction: 5' Facility: TIGR
Clone: SGN-C185304 [TUS-47-A14] Trace: SGN-T191920 EST: SGN-E390594 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390836Length: 702 bp (876 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390836 [] (trimmed) ACCAGAAAGTCCATTCCATTAGAAATCTATTAGTACATGGGAGAGTTTTACAAGGTGTTTTTGGCTAATATACTATATGATAAATAGTACAATTT
AATTAGGGAAAATGCCTTTAGGGATAATAACATCCCCAATGTTGTTGTGCCATGGGTCAGCCAAGTGAGTTGCCAAGTTCTCCAATGGTCCTGTT
CCTGGATATGCTGATTGTTGTACACAAAATCCCACAAATGCCAACAATGCAAGACGACCATTCTTGATTTCCTTGACTTTGAGTTCTTCAAATTT
AGCAGGGTCTTTAGAGTAGCCCAATGGGTCAAAAGCCCCACCAGGGTACTTCTTCTTTTCTGAATCTTTTTCCATACTCCTTTGGTGTTCTACAA
AAGCTATGGCTAGAAATTCAATAGCCAAAATAGTAGGAAGTGTTCCCCATGGAACAGGCTGGCCCAAATATGTAGCTTGTCCACCAGGAATGGCT
GCCCATTCTTGGGCCTTGACCCAATTACCTAAGCCCAATGCCTCTGGTACTATGATTCCGGGAACAGCAAGCATAGCCCATCTGCAATGAATAAG
TTCAGATTCTTTGTATCTTTCCAAATTTGCAGGTACTTCTCCTAAACCAAGTGGATCAAATCCAAAATCTCCGGGGGCTGAGCCGTCGAGGTAAG
ATGGACGGGGCTGCCCGGGCATCCAATCAGCTGACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390836] SGN-U580126 Tomato 200607 Build 2 162 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192162 [Download][View] Facility Assigned ID: FA0AAD35BA07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5