EST details — SGN-E390957

Search information 
Request: 390957Match: SGN-E390957
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185240Clone name: TUS-46-N22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185240 is on microarray TOM1 spot ID 1-1-3.2.11.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C111124 [cLPT-7-J4] Trace: SGN-T179143 EST: SGN-E367581 Direction: 5' Facility: TIGR
Clone: SGN-C185240 [TUS-46-N22] Trace: SGN-T197619 EST: SGN-E396293 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390957Length: 405 bp (869 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E390957 [] (trimmed) AAAAAAAAAAAATAAAAAAAAAACTTGCAATTAAAACCCAGTCCGGGCCAAATAAAAAAATTCCCCCCCCCTTACCAAACCCCCCAAAAAAACCA
AAGGGAAAAAAGAATCGGGGGACCGGCAAGGGAAGGGGTCCCCCTCCTCCCCAACCCAAATTAAAAAAAAAAAAACCAATTCAAAACAAAAGAGG
CAAAATAAAAAAAAGGGGGCGGGAAAAAAGAAAATTTTACATTAAAAAGGGAAAAAACCCCCCCCCAAAAACGTTGCTTTTTCCGAGCCTTGTTG
ACCATTTCCGGCCCTCCCCCCCCCTCCGATGATAAACGGAAGGAAAAGGAAATACCGCCCCTAGAGTTGGGGGAAGGGGCGGGGGGGAAAAACTA
AATCCAAAAGGAAATGGGGCGGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390957] SGN-U602997 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192283 [Download][View] Facility Assigned ID: FA0AAD34DG11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.850 Expected Error Rate: 0.0423 Quality Trim Threshold: 12.5