EST details — SGN-E391028

Search information 
Request: 391028Match: SGN-E391028
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185557Clone name: TUS-47-L3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185557 is on microarray TOM1 spot ID 1-1-6.4.10.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76276 [cLES-17-H9] Trace: SGN-T101428 EST: SGN-E288986 Direction: 5' Facility: TIGR
Clone: SGN-C185557 [TUS-47-L3] Trace: SGN-T192355 EST: SGN-E391029 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391028Length: 643 bp (826 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E391028 [] (trimmed) AAACATATAACCACCGATTCATCATTATTAATTTCTCATAACTTGGTCGGAATCGAAGAAAATACACCGGTACAAATAGGAACAAAATGCAAAAC
AAAAATTGAAGAAAAAAAATTAAAGACTTAGGTACAAATCAAACAAACATTTTGATTATATGTTTGGAAATTTAGAATCCTTCTGGCTTGTAGGC
AATGAAGCTGATGCACTGGACTTGACGAACGTTGTCGAATCCGATAATACGAACCCAGGCTTGTGGGTACGCCTTCTTCGCCTCTTGAACCTCAG
CCAACACCTGTGTTGCATCAGTGCACCCAAACATAGGTAACTTCCACATGGTCCAGTATCTACCATCGTAGTATCCAGGGGAACTGTTGTTCTCT
CGGTACACAAATCCGCGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTTTCAAAAGATACTCAATTTCGCTAAGCAATTGCTCATCGGA
CAAGTCAGGAAGGTATGACAATGTCTCGTATTTCTTCATGTTGATTGGTGGCCACACCTGCATGCATCTAACGCGTCCACCATTGCTAGCAAGGG
AGGTAATGTCAACGTTGTTGTTCTTCTTGGTAACGGGAAAAGAAGCGGCGGATTTGAGTCCGGTGAAGGGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391028] SGN-U578246 Tomato 200607 Build 2 245 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192354 [Download][View] Facility Assigned ID: FA0AAD35CF02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0015 Quality Trim Threshold: 12.5