Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E391239

Search information 
Request: 391239Match: SGN-E391239
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185989Clone name: TUS-48-N3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185989 is on microarray TOM1 spot ID 1-1-6.2.7.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69661 [cLER-12-D2] Trace: SGN-T94282 EST: SGN-E283315 Direction: 5' Facility: TIGR
Clone: SGN-C185989 [TUS-48-N3] Trace: SGN-T192566 EST: SGN-E391240 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391239Length: 182 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E391239 [] (trimmed) CAAGAAGAATAATAATAACTTGGCCTTATGATTACGGGCGGTTTTGCTTGGTGGATCACTTGTAGGACTGATCTTCGGAGATGCACTATCGTATG
TTGGAAGAGGTTTTGATGTTGGATTAGATGATGCTGATGCTCTCTACAAGGCTTGCCTGTATGCTGGAATTAACATTACTGGTACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391239] SGN-U578728 Tomato 200607 Build 2 85 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192565 [Download][View] Facility Assigned ID: FA0AAD36CG02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 1.0000 Quality Trim Threshold: 14.5