Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E391295

Search information 
Request: 391295Match: SGN-E391295
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185515Clone name: TUS-47-J9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185515 is on microarray TOM1 spot ID 1-1-8.2.9.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C74759 [cLES-11-G24] Trace: SGN-T99880 EST: SGN-E286349 Direction: 5' Facility: TIGR
Clone: SGN-C185515 [TUS-47-J9] Trace: SGN-T192347 EST: SGN-E391021 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391295Length: 677 bp (844 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E391295 [] (trimmed) GAAGTTGTAAGATTAAAGGATCATATAAAGAAAGGTGTTCAAAATAGTAATGAATATAGATAGGGGCAAAACTTTCTGGTAACAAAAACATTCAT
CAAAATTGACCTACTAAGGAAAATAGCTTAAATCCATAGGGAGACCAAACATCTATAAACTAAAAAAATAAAAATAAAAATTCTTTGCTCTTCAA
CAACATCTTCCAAGCACTCTACTTCCTTCCTTGCTTGCCCTTGAAGTTCTTTTGGCCACTGAAGTTCTTGTTGTTAGATTTGTTGCCGGAGAACT
GACCACCAGATTTTGGGGACTGAGTTTTCGGTTTGTTGTTACCATTGAATGCAGGTTTACCATTTTGCTTAGCAGAAGGGGTGGCTGGACCTTTC
TTACCACCTGACTTGTTGTCGGGGGTTGCTTGTTTAGCTTTTTTGCCGGAGCCAGGAGCTACTTTAGGAGATGGAGCTGGTCTCTTCTTCTGCTC
AACCTTTTTAGGTGTCTCTTCTTCTGAATCATCATCTTCCTCGGAATCATCATCATCCTCGGAATCATCAGAAAGATCCATCCCTTCTGGTCCAT
CCATGCCTAGAGGCACATCATCAGAGTCATCTTCAGAATCGTCTTCATCATCAGAGTCATCTTCAGAATCGTCATCATCTTCATCAGATTCCGTC
TCTTTCTTTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391295] SGN-U564113 Tomato 200607 Build 2 77 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192621 [Download][View] Facility Assigned ID: FA0AAD35CE05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5