Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E391594

Search information 
Request: 391594Match: SGN-E391594
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173436Clone name: TUS-16-C2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173436 is on microarray TOM1 spot ID 1-1-7.3.18.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2577 [cLEC-16-H23] Trace: SGN-T26912 EST: SGN-E205023 Direction: 5' Facility: TIGR
Clone: SGN-C173436 [TUS-16-C2] Trace: SGN-T192919 EST: SGN-E391593 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391594Length: 677 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E391594 [] (trimmed) GGCCTCTTCAAAACCCCTTAAATTATAACTTATAATATCTCCAATACTTGCAAAATACAAAGGAAAAAAAAATGGTTAGTCCATCCATTAATTCC
CATAATTTTCCTCTAAAATTCCTTTGTAGCTATGGTGGCAAGATTATCCCCCGTCAAACCGATGGAAAACTCCGGTATTATGGTGGCGAAACTCG
TGTCCTCTCCGTTGATCGTTCCATTTCATTCACAGAACTATTAGTGAAGCTAGGGGAGATGTGTGGATCGTCAGTGAGTTTAAGATGTCAGTTAC
CAAACGAAGATCTAGATGCTCTTGTATCGATAACATCTGACGAAGATTTAGCCAATTTAATCGAAGAATATGATCGTGTTTCAAAAATATCATCG
TTTCTCAAGATGAGGGCTTTTTTATATCCACCAAAATCCACAAAAAAAGTTGTATCTCCTACACCTTCTATTGCTTCTACCTCATCTACCAATAG
TACCACTATCAGCAACCCTGATGTCACGTCATCACCAAGTTCATTTTGTTCAACCGTTACTAGCCCTCCTACATCAACGAGGCATCATGATTGTC
CAAGACCATATAAGAAAATGGCACGAAATTCTTTAGATGAAACAATTAACGGACGCATACGTCATATTAGAACAAGATCGTCACCGGTGATGTTT
CCTATTTGTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391594] SGN-U571663 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192920 [Download][View] Facility Assigned ID: FA0AAD4BB01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5