EST details — SGN-E391810

Search information 
Request: 391810Match: SGN-E391810
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176649Clone name: TUS-24-H23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176649 is on microarray TOM1 spot ID 1-1-2.4.9.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C27187 [cLEF-42-M7] Trace: SGN-T60731 EST: SGN-E247687 Direction: 5' Facility: TIGR
Clone: SGN-C176649 [TUS-24-H23] Trace: SGN-T1421 EST: SGN-E378527 Direction: 5' Facility: Giov. Lab
Clone: SGN-C176649 [TUS-24-H23] Trace: SGN-T193384 EST: SGN-E392058 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391810Length: 568 bp (799 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E391810 [] (trimmed) AATCATGTTACCATATCTACCCATCGGTTGGCATCAAATCTGAGAAGCATTGGAAATCTAAATCAATTTATCGAAGAAAATGGTTTCAATTTGAA
CTCTGAAGGGGGTTTTCTAAAGGTGAGCCCTGATGGTCTTTTGCTGCAAAGTTCAACTGTAGCAGATTCTACCTTTTTCGAATTTTCAGACGGCA
TTACAGAAGCAGTACCTTGTTCATACATTGAATTTGCTGAGAGACTTGTACTACCGCAATATAAAGATTTACCAGCAGAAAAGGTGGAGGAGTTT
CACAGGCGGGACGGGTTTGAAGTTGGAAATGCCGACAAGATATTTGAGAGTACATCCAAGGATCAGTTAACTCGTCGTGCTGCATGAAAGTAAGC
GCGAAGCAGTTGGATGTTTCGACTCTGTGGAGCTAATTCTTGGCATGTTCAGCTGGATGACTACTCCAAGATTAAACTGTTGTTGAAAGAAGATG
ATATTGTAGCTCTGAAAGTATTATTATCTGTAACTATCACAAATTTACTCTTGGCATATACACCTGATATATCAATAAATTAGTTTGGATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391810] SGN-U578798 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193136 [Download][View] Facility Assigned ID: FA0AAD12CD12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5