Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E391840

Search information 
Request: 391840Match: SGN-E391840
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176831Clone name: TUS-24-P13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176831 is on microarray TOM1 spot ID 1-1-4.4.9.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C27979 [cLEF-46-D15] Trace: SGN-T61802 EST: SGN-E247391 Direction: 5' Facility: TIGR
Clone: SGN-C176831 [TUS-24-P13] Trace: SGN-T199155 EST: SGN-E397829 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391840Length: 669 bp (830 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E391840 [] (trimmed) CAGCCCCAACCAATTGAGATTTCTCGCCGGTGAACTACCACGCCGAATTTGCATTGACTTCTCTTCGTCTCCGGCACTGTTTTTACGAGAATCCA
TGGGTACTTCCGACGTTAATGCTAACTCCTCCTCCTCTTCCCTCGTCAAAGATTTCCTCCACAAATGCGGTGGCGTTGCCGTGATTGACGGCGGA
TTTGCGACGGAGCTGGAGCGTCATGGAGCCGACCTTAATGACCCTCTTTGGAGCGCTAAATGTCTCCTCACTGACCCTCACCTTGTCCGCGCTGT
ACACTTGGATTACCTTGAAGCTGGTGCAGATATAATACTCAGTTCATCTTATCAGGCAACCATCCAGGGGTTTAAGGCCAAAGGATATTCTATAG
AAGAAAGTGAATCCTTACTCAAAAGAAGTGTTGAGATTGCATGTGAAGCACGTGATGTCTACTATAAAAGATGCCGTGAATCTTCCTCTGATCAA
AGCACTGATGGGAAGGTTCTCAAACAACGCCCTATCTTAGTTGCAGCATCTGTTGGGAGTTATGGGGCCTATTTAGCTGACGGTTCAGAATACAG
TGGGGAATATGGGGATGCGGTTGATCTCAAGTTTCTAAAGGATTTTCATCGTAGAAGGGTTCATCTTCTTGCAAACTCTGGTGCTGATCTAATAG
CTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391840] SGN-U582642 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193166 [Download][View] Facility Assigned ID: FA0AAD12CH07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5