EST details — SGN-E391965

Search information 
Request: 391965Match: SGN-E391965
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177930Clone name: TUS-27-N8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177930 is on microarray TOM1 spot ID 1-1-1.2.6.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64268 [cLEM-5-K14] Trace: SGN-T85213 EST: SGN-E271408 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391965Length: 557 bp (844 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E391965 [] (trimmed) GATTGGGAGGACCATACTCTCTCCTTATGTAGCTAAGTTAACTCACACTTGCAGCCTCTACACAAGCGTTGAGCAAATATCCTTTTCCACTCTTC
TTTAGCTCTCCTCTCTCTCTGTTCCAGTGTTTCTTTTTCTGCTGATGGAGGAGCTCTACTGTCATCTCAGTTGACGACCGATACTTCATTTTTAT
GAACTTTCTGTATTTGGGTTGCAAGCTATTCTGGATATGTTCTTGACCCTTTTCGTTTTTGCTGATTTTAGTGGCTAGGAGGGTATATATTCCAG
GTAAACAAATCTGGGTCGACGTGTTCTTGAAGTTTCATCTCATGGTTTGACTGATTATTTTTGCTCCAGGGAGACAATTGGCAAAAGGGTGCGAG
GTAGAGGAAAGGGTAAGAAATTGACTGATGATCAATGAAGTGATGACGAAGAAAAGATCCCTCTCCAGAACATGAGAGGAAGGCCAGCATTATCG
ATCGTACATGACGTTGATGAAGAAGCAATAGAGATGATTGAAGAGGAGGATGAGTCTGATCTTGGAATTCACAACTTGGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391965] SGN-U587920 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193291 [Download][View] Facility Assigned ID: FA0AAD15DG04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0211 Quality Trim Threshold: 14.5