Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E392072

Search information 
Request: 392072Match: SGN-E392072
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176745Clone name: TUS-24-L23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176745 is on microarray TOM1 spot ID 1-1-2.4.9.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C27779 [cLEF-45-I12] Trace: SGN-T61272 EST: SGN-E246537 Direction: 5' Facility: TIGR
Clone: SGN-C176745 [TUS-24-L23] Trace: SGN-T193151 EST: SGN-E391825 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392072Length: 553 bp (834 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392072 [] (trimmed) ACCGATGAAATGCCCATTAAAATTATGAAATACCCCCCAATTTGACAGCAATCTGGCAAAAATTAACAAAAACATTGGTCAATGACCAACATCCA
TCAATTACTTTACATGAAACTACTAACCCCTTTCAAAGCACCCCCAAAAAAAAAACAGTAAAAAAAAAAAAAAAACACCATAAACATATTTGAAA
TGTGCACCATCTAATGCACAATTTTTTTTATCATGAGCAGCAACCCCCCCCCCCCCGTTGGGTTTGCCGTTCTTGTTTCCGTTTCAAAAAATTTC
CCTTCCCTACAGTGGATCCTTCTTCAAGGAAACTAAGCCCCCCCCTTATCTTTAAGGCAAGCTCTTCAAAGCAATTTTGCACATTTTCCCCAGTT
TTAACACTACATTCAAAAAATAAACCCCCCAGTTCCTTCCCTAAAGCAATGCCTTCTTCCCTGGTCACAACTCTCTCGGATTCTCTGTCAACTTT
ATTTCCAACCACCATCTTTACACAATCCCGATTATTACTATACAGCTCCCCCTCTTTTGCCCACCCATCAAAAAGGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392072] SGN-U595228 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193398 [Download][View] Facility Assigned ID: FA0AAD12CF12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.886 Expected Error Rate: 0.0262 Quality Trim Threshold: 14.5