EST details — SGN-E392106
Search information |
Request: 392106 | Match: SGN-E392106 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C176590 | Clone name: TUS-24-F12 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C176590 is on microarray TOM1 spot ID 1-1-5.2.9.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C27070 [cLEF-42-H18] | Trace: SGN-T60671 | EST: SGN-E247627 | Direction: 5' | Facility: TIGR |
Clone: SGN-C176590 [TUS-24-F12] | Trace: SGN-T193433 | EST: SGN-E392107 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E392106 | Length: 219 bp (883 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E392106 [] (trimmed)
CTAACCCCAAAATTAAAAAAAAAAAAAAAAAAACCTAATTCCCCAGGGCCCCAAAAATCTTTAACAAAAATTCCCAAAAAAATTTTTTTTTTTCC
AAAAACAAAAAAATCCCCACCCCCCCGGGGGACAAAAAACCTCCGGGCAAAACTCCCCTCCCCAAAAAAAAAAGACTTGGGGCACACTACCATTA
AAAAATTTACCCTTTCCCCCCCCCAAAGC
AAAAACAAAAAAATCCCCACCCCCCCGGGGGACAAAAAACCTCCGGGCAAAACTCCCCTCCCCAAAAAAAAAAGACTTGGGGCACACTACCATTA
AAAAATTTACCCTTTCCCCCCCCCAAAGC
Unigenes |
Current Unigene builds | |||||
[SGN-E392106] | SGN-U602762 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T193432 [Download][View] | Facility Assigned ID: FA0AAD12DC06FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.721 | Expected Error Rate: 0.0285 | Quality Trim Threshold: 14.5 |