Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E392201

Search information 
Request: 392201Match: SGN-E392201
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180300Clone name: TUS-34-A2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180300 is on microarray TOM1 spot ID 1-1-7.1.19.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28078 [cLEF-46-H9] Trace: SGN-T61726 EST: SGN-E247315 Direction: 5' Facility: TIGR
Clone: SGN-C180300 [TUS-34-A2] Trace: SGN-T1620 EST: SGN-E378195 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392201Length: 440 bp (837 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392201 [] (trimmed) GGTGTAAACACTGAATACGAGTAAAGTTTATTCCATGAAATGGTGTGTAAATCCGATGTCCTTCAGCACAATGAAAAAAAAAAACACAAACTTGT
AAAATTCTTCTAAATTTACCAAGCCCTACAACTTGTGTTACATGTTTTAATGATGAATACATTGACAAATATGGGGGGAACCATGCCATCTTGAT
GGTTGAATAAATATCTACAGGAAAAATTGAATGTGAAATTCCATTTCACTGTTTTTCCACTAAAAAGATTTGAACATTCTTAACTAGTAGCTTTA
TTAACTTCATCAAGCTGCAAGGACTAACACTTTTATAGTTCCCTGGCTATTAGCAGCTAGCATCGTAGGGCTATCGCTCTTCCAGCACACTGCGC
TGATGAAATAAGATCCTGCATCTTCATCCGCTTCTTCTATGTCTGGGGAACCAAGTCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392201] SGN-U579490 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193527 [Download][View] Facility Assigned ID: FA0AAD22BA01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5