Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E392214

Search information 
Request: 392214Match: SGN-E392214
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181120Clone name: TUS-36-C6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181120 is on microarray TOM1 spot ID 1-1-3.3.15.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24432 [cLED-8-D6] Trace: SGN-T50831 EST: SGN-E232898 Direction: 5' Facility: TIGR
Clone: SGN-C181120 [TUS-36-C6] Trace: SGN-T193541 EST: SGN-E392215 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392214Length: 579 bp (863 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392214 [] (trimmed) CCAAAATAAAATAAAATATTATTAAATCTAAAAATATTTTCTTTCTTTGAAACCTAAAACCAAAAAAGGACAAAACCCCAACAAAATTTCCATTT
TCAAATTACCCAAAAAAAAATTCCAGGCCCTCCCCCACCTATTTTCAGCCACCAGGGTCTTCCCCAACCACCGAAATATTGGGAAAGGGGGACCC
CCCCCAACAACGGGGGGAACTTCGGCGCCGGCAACGGCAATTTCCGGCAAACGGGACATGAACCTTTCATTTTCCCCCCCCCTTCTCCCCCCATC
ACAGGAAAAAAAGGCTTACCCCCGGGAAACCCCCGAAACATCCCCCCTTCCTTGAAACCCCACAAACAAACCCCACACCCAACGTCTTTTCGGCT
TCCGTTTCCGTTTCCCCATTTTCCGTTTCGGCTGGAGTAAATTATTTTGGGGAAAAAGTTGATTACGGCTTGATTGAGGCCCCCAAAAGGGTTCT
AAAATAAAACGCCCCCTTTTTCGTCTTCCTCACCAACAAAAATTACCCCCGAAAGGAAAATCCCGGGGTCCGGGTTCCAAGACGGGAATTGGGCT
TGACGGCGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392214] SGN-U597149 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193540 [Download][View] Facility Assigned ID: FA0AAD24BB03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.907 Expected Error Rate: 0.0274 Quality Trim Threshold: 14.5