EST details — SGN-E392590

Search information 
Request: 392590Match: SGN-E392590
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180725Clone name: TUS-35-B19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180725 is on microarray TOM1 spot ID 1-1-6.2.17.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C68999 [cLEN-8-J23] Trace: SGN-T88746 EST: SGN-E274050 Direction: 5' Facility: TIGR
Clone: SGN-C180725 [TUS-35-B19] Trace: SGN-T193917 EST: SGN-E392591 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392590Length: 344 bp (866 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392590 [] (trimmed) GACAGACAAGGAAGTAAATACAATGACACCAGCTTACTAGTAAATAAAATAACATTTCATATTTTTAGCTTACTGATTTATTTCAGTCCACTAAA
AATAAATAAAAATACAATTTCATGTAATACTGGGCTGCTTAATGGAGTTTGAACTCATTCACCATCTCCAACATGACTTACATCTCGATCGGGGC
TATGAAACAAACAATCTGGATAAACAACAAGTCTTTGTTCTAATCAGTATGGCAAAGATTCCATAACAAGGCAGATGGAAAATACCAACAGCAAA
GTACCAAAGGGGAACATATTGAGATGACAAGTCCAAAAAGGGATACCGCCACCTCAACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392590] SGN-U585544 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193916 [Download][View] Facility Assigned ID: FA0AAD23CA10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.910 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5