Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E392620

Search information 
Request: 392620Match: SGN-E392620
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180904Clone name: TUS-35-J6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180904 is on microarray TOM1 spot ID 1-1-3.2.17.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C977 [cLEC-10-F11] Trace: SGN-T24854 EST: SGN-E201267 Direction: 5' Facility: TIGR
Clone: SGN-C180904 [TUS-35-J6] Trace: SGN-T193696 EST: SGN-E392370 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392620Length: 573 bp (865 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392620 [] (trimmed) ACTAGGTCCAAGCTTGATATGAGTCGAAATAAGTTGTTTGGAAGCATTCCAGAGAGTATAGGAAGATTGAAAAGTCTTTCATATGTTGATTTGTC
TGAGAATGAGTTATCTGGAAAGATTCCAAACTCTATTGGAAACCTTTCTCAAGTATCTCTAATGTATCTGAACCAAAACCAATTGAGAGGAAAAA
TCCCTTCATCAATATCTGGTCTCAGCTCATTGGTGTTCTGCCGTTTATCCGAAAACCAGCTGAGTGGCAGTATTCCACCTTCTATTGGGAATCTT
CCGAAGATCCAAAGGCTAATATTTGAGAACAACAAGTTAAGTGGAAAACTGCCTGCAACACTTGGACATCTTGTAACTCTCACTGATATGTACTT
TTCCAATAATCTATTTACAGGGAAAATCCCATCAAGTTTTGGTAATCTGAAGAATCTACAGATACTAGATTTGTCGAAAAATAAGCTCAGTGGTG
AAATCCCTCATCAGCTTGTGAAGTTAGTGAGTTTACAGACATTGGATCTGTCATTTAATCCTTTGGGGCTTTCAAGAATACCAAACTGGTTTAAA
AAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392620] SGN-U572099 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193946 [Download][View] Facility Assigned ID: FA0AAD23DE03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5