Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E392814

Search information 
Request: 392814Match: SGN-E392814
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181500Clone name: TUS-37-C2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181500 is on microarray TOM1 spot ID 1-1-7.3.12.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181500 [TUS-37-C2] Trace: SGN-T194334 EST: SGN-E393008 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392814Length: 567 bp (817 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E392814 [] (trimmed - flagged) GGCCTCTTCAAAACCCCTTAAATTATAACTTATAATATCTCCAATACTTGCAAAATACAAAGGAAAAAAAAATGGTTAGTCCATCCATTAATTCC
CATAATTTTCCTCTAAAATTCCTTTGTAGCTATGGTGGCAAGATTATCCCCCGTCAAACCGATGGAAAACTCCGGTATTATGGTGGCGAAACTCG
TGTCCTCTCCGTTGATCGTTCCATTTCATTCACAGAACTATTAGTGAAGCTAGGGGAGATGTGTGGATCGTCAGTGAGTTTATGATGTCAGTTAC
CAAACGAAGATCTAGATGCTCTTGTATCGATAACATCTGACGAAGATTTAGCCAATTTAATCGAAGAATATGATCGTGTTTCAAAAATATCATCG
TTTCTCAAGATGAGGGCTTTTTTATATCCACCAAAATCCACAAAAAAAGTTGTATCTCCTACACCTTCTATTGCTTCAACCTCATCTACCAATAA
TACAACTATCAGCAACCCTGATGTCACCGTCATCACCAAGTTCATTTTGTTCAACCGTTACTACCCCTCCTAATTCAACGAGGGATCTTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T194140 [Download][View] Facility Assigned ID: FA0AAD25BB01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (ends match significantly different genes in arabidopsis)
Sequence Entropy: 0.962 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5