Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E392858

Search information 
Request: 392858Match: SGN-E392858
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181110Clone name: TUS-36-B20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181110 is on microarray TOM1 spot ID 1-1-5.2.14.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C18139 [cLED-22-C22] Trace: SGN-T54155 EST: SGN-E238089 Direction: 5' Facility: TIGR
Clone: SGN-C181110 [TUS-36-B20] Trace: SGN-T194080 EST: SGN-E392754 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392858Length: 608 bp (833 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392858 [] (trimmed) ACTTTCAAGTGTTATTTTGGACCTGGGGAAAAATCACCAAAATACATACAATGTTTGATGGTATGCAATTACAAAAATATTCAACAGTATATAAC
CCCAACAGGTTTCTGGTCTTTTTTATAAAACCATTTCAAAACCCAAAATCCCTAGGTCAAAGTTGAAACCAACAAAAACAAATGCCCTAAATTGG
GACCCAAAATATACATATAAACGTATTTATCGGGGTCGGAACTTGGGTCTAACTGTGATCCCCCCGGGCCTTGTCCCCCCAAAACAATATCCCTT
CCCCCCAAAAAACCTTCTTAAACCCTTTGGAAGTGCACCTTGTCCCCGGCTATAAATACCTTTACCTGTTATGACCCCTAAAAAAGCTGGCCCCT
GCTTATTCAATAGGTGGGACCCTTTGCTCTCATTCCCCACATCAAAAAAAACAGCACCTCCAAAGCTGCCCTTATTCTGTGCCCCCTGAAATTCA
ATCTTTTGCAAATGTTCTTGTAAGGCTTGAACTGCCTCTTTTGCATGAAAACCATGCAAGTCCAGTGTCCCTTGATCATTCTTACCGTTGCAGGC
AGTCAAAATTTCTTTTGCAGCCTGGGCATTTACCCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392858] SGN-U595487 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194184 [Download][View] Facility Assigned ID: FA0AAD24DA10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0212 Quality Trim Threshold: 14.5