EST details — SGN-E392908

Search information 
Request: 392908Match: SGN-E392908
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181531Clone name: TUS-37-D9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181531 is on microarray TOM1 spot ID 1-1-8.4.12.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C49831 [cLEI-9-M1] Trace: SGN-T81671 EST: SGN-E265390 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392908Length: 191 bp (892 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E392908 [] (trimmed) TTTTTTGTCGATGACTTCCCTATTAGAAGATACCCTAAAAAAAATGATGCAACATTTCCACAAAGACCTATGTATGTCTATGGTTCAATTTGGGA
TGCATCATCTTGGGCAACGGAGGAAGGACGAATTAAAGCGGATTATCGATACCAACCTTTTATCGGAAAATATAGTAATAATTTCAAGGTTGAAG
G
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392908] SGN-U562982 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194234 [Download][View] Facility Assigned ID: FA0AAD25CB05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5