EST details — SGN-E393044

Search information 
Request: 393044Match: SGN-E393044
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181538Clone name: TUS-37-D16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181538 is on microarray TOM1 spot ID 1-1-1.4.12.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C143002 [cTOF-21-G16] Trace: SGN-T158000 EST: SGN-E344719 Direction: 5' Facility: TIGR
Clone: SGN-C181538 [TUS-37-D16] Trace: SGN-T194371 EST: SGN-E393045 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393044Length: 571 bp (841 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393044 [] (trimmed) GAAACATATAACACACCACACAATTTTATTGACTCATAAAGAGATTTACAACAGAACTAACACTTCATCAAGCTCATGAAGCATCATATATCACA
CCAAGTAGGTTTATTTATTAACAAATATTTAGGATAGTCATGATACTTCATCATCTTATTAGTAATGGGGAATGATATTTATTTCCCAACATGGT
GAGTCTCAAGGTCCTTGATGAGATAGATAAGAAACTCTATAAAATCCAAGGGCTCTGGAGTATTTTCATTCAATTTCTCATACACAAGAGTCCAA
GTGATAAAGTTTTTCTCTGCAATCAATGTAAGTGTCAGTGTCATTGACTTGTATAGTTCATTCATATATCCTTCTTTAAAGTTGAAAGTGATTGA
TTTTTCCTCATCGTCTATGTGTAGGACTTGTTTGGCATGCCTCTCTTTTCCTCCAAGAATATAATTCCAGCTAACAACAGAGTTAGTTTTTCCTA
ATTGACCTTCATGAAGTGTAAAATTTGTTATTTTATCAGGAGCCATGGCGGATGTTTTGTGTGGATTTGATTTGAAGTGCTCATGAACCAAATGT
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393044] SGN-U564604 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194370 [Download][View] Facility Assigned ID: FA0AAD25DB08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5