EST details — SGN-E393081

Search information 
Request: 393081Match: SGN-E393081
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181686Clone name: TUS-37-J20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181686 is on microarray TOM1 spot ID 1-1-5.2.12.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181686 [TUS-37-J20] Trace: SGN-T194624 EST: SGN-E393298 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393081Length: 353 bp (848 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393081 [] (trimmed) GCATTCTCCATTCTTGGAAGTGGCCATTCTTGATTTCTTGAAACAAAGAAATTCAGAGTGGCCATTGTTGAAAGAGAGGGTGGAATTTGTAAGTC
AAGAAACAGGTTACTCCTGTTTGAGTGAGGAAAAGTTGGTTTGCCTGTCTGTGGTCTTTTTATAATCTTTTTCTACAGAAGAGAAAGTGGGTAAT
TTTGTTTGAGAGTGGAAATATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTAAGTAAAGTTTGGAAGGTGACAAAAAGAAA
GACAAAAGTCTTGGATTTGTTTTTAGACAACCAAGGTTTTCTTGCTCATAATGTCTGCTGCCTTGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393081] SGN-U580527 Tomato 200607 Build 2 240 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194407 [Download][View] Facility Assigned ID: FA0AAD25DE10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0114 Quality Trim Threshold: 14.5