EST details — SGN-E393201

Search information 
Request: 393201Match: SGN-E393201
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181987Clone name: TUS-38-G9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181987 is on microarray TOM1 spot ID 1-1-8.3.10.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C4408 [cLEC-25-H1] Trace: SGN-T28671 EST: SGN-E205255 Direction: 5' Facility: TIGR
Clone: SGN-C181987 [TUS-38-G9] Trace: SGN-T194528 EST: SGN-E393202 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393201Length: 477 bp (842 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393201 [] (trimmed) ATAAAAAACTAACTTTAACTTTTATACACTTATAATGTGAACAAAAGATTTACAATATGGATAATTATAACAATGTAATGAAAAACTAGACTACA
CATGCATAATGCATACACCTCCAAGGCCCTCTAAAAAGATCTTTTTTTTTTTTACTCAGTACTAAGTTATACTCTACAAGAAAGCAAATAGATCG
AGTTAATAAATAACAAGTCGTCATTGGGTATGATTCTTGAAATAGTCAAGACGACTATCAGCCAGACGTAATGAATACACAATTTGTTTAAAGTC
CCCCCACTTGAAAGGCTTATAAATATTAGTAATATTGTTGATTTGAGGAGGAGCACTTATCCAAGCGCCAAGAGCAGGAGCTGCAAAGTACATCA
TGGACATTCTACTTTTCCATGAATTTATTGACACCACTCTATGTCTTACACTGGTAAATCTACCATTCGTCAACGCCTGAAAGGAATCCCCTACG
AA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393201] SGN-U568917 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194527 [Download][View] Facility Assigned ID: FA0AAD26AD05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5