EST details — SGN-E393255

Search information 
Request: 393255Match: SGN-E393255
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181954Clone name: TUS-38-E24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181954 is on microarray TOM1 spot ID 1-1-1.1.10.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7006 [cLEC-37-I16] Trace: SGN-T31205 EST: SGN-E208214 Direction: 5' Facility: TIGR
Clone: SGN-C181954 [TUS-38-E24] Trace: SGN-T194582 EST: SGN-E393256 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393255Length: 312 bp (889 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393255 [] (trimmed) AATAAACACTCTTTAAATTTGTATTAAATGGTCTTTGCAAAACCTAATTAAAGTCTCGTAATGTTTTACATATACACCCACAAAGAAAAAAGAAA
ATAGTACAAGATTACTTGCAAAATTGAGTAAAATAGCAAGAACACGACCCGACAGATGATATCATCTGAAAAAACACGAGACAAACAAACGAAAA
AGAAAAAGAACTAGTGGGTTTTTGAACTGATTCAAGTGGAAAAAACAAGTTAACAAAATTTGCAGCTCTTTCTACAGCTTCCTGGGAGGTCTGTA
CTTCTCACCATATATTCTGGGTTCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393255] SGN-U566163 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194581 [Download][View] Facility Assigned ID: FA0AAD26BC12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.898 Expected Error Rate: 0.0129 Quality Trim Threshold: 14.5