EST details — SGN-E393341

Search information 
Request: 393341Match: SGN-E393341
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182037Clone name: TUS-38-I11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182037 is on microarray TOM1 spot ID 1-1-6.1.10.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C4800 [cLEC-29-F6] Trace: SGN-T29486 EST: SGN-E206233 Direction: 5' Facility: TIGR
Clone: SGN-C182037 [TUS-38-I11] Trace: SGN-T199339 EST: SGN-E398013 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393341Length: 603 bp (843 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393341 [] (trimmed) AAATGTAATTACTATATTGCAAAGTTTACAACCATGAGAAAATTATTAGCTAGAAGAAATAATATCCTCAAACTCTTTTTCTTTTCTACATATAC
ATCAAATTAAGATGATTTATGCATAAATTCGAATCGAATCGAATCACTTAGTTTCCAAAGTTCTATAGTCCAAAAGACCATTAGTCTTCAAGCCC
AAAAAGTCATAACCAGCCATAATGTTCATACTTACCATATTATTACTCCATCCATTTCCATTACTTTCACTTCCACAACTGCAATCTTTACTATT
TTGAATTCCCAAACTACATGTAAAACATAAAGAGCTTGATCGTTGATGATGACGATGATGATCGAGTTGTTGATGATGTGGAGGACTAATTCTGA
GTTCAAGATTTAAGTCAGGAAGACATGATGATGACTTTTCTTGAATTATTTCATTATTATCTGATTCTTTGCTTGTTTCAACGAATTCAGCTTTG
ATATTTATCATCTCATCTTGTTGATCAATATCTTTAATATTTTCATGAGCAGCAGCAAAAGTAATCGTTGTAACTTTTGGTATTGTAGTAGGATC
ATTGATTGATCTATGTGTTGTTGGATCAATACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393341] SGN-U563435 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194667 [Download][View] Facility Assigned ID: FA0AAD26AE06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0057 Quality Trim Threshold: 12.5