EST details — SGN-E393456

Search information 
Request: 393456Match: SGN-E393456
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181886Clone name: TUS-38-C4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181886 is on microarray TOM1 spot ID 1-1-5.3.10.7 [Order] [Tomato Microarray Database]
See unigene SGN-U568462 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C6344 [cLEC-35-C20] Trace: SGN-T30803 EST: SGN-E210455 Direction: 5' Facility: TIGR
Clone: SGN-C181886 [TUS-38-C4] Trace: SGN-T194565 EST: SGN-E393239 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393456Length: 340 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393456 [] (trimmed) ACAGCTACAATTCTTCTTGCAGTACAATAGCTGGCCTTGAAATGCCCCCCTTTTAAAATGTAGTGAATCTAAGACAAGACATGTCATTATTAAAG
TTCTGTACCAAAATGAAAGATGCAGTAAACAAGGTGAAATACTGTAACATGTAGAGAAACTGCTGAGATCTCATAAGCAGTATGCATAGCATAAA
TAATTATTCCAGTGGATATTGGGAATTCATCAACAGCATTAGAGCCTTTCACGATGTCTTGGCCTTTGGCGGTGCTGGGAGCAACTGATAACATG
ATATCAAGGAGCTAACAAATCCAAAGGCTCCTGTTACACGGGGAGTGACTTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393456] SGN-U568462 Tomato 200607 Build 2 62 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194782 [Download][View] Facility Assigned ID: FA0AAD26BB02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5