Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E393457

Search information 
Request: 393457Match: SGN-E393457
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181890Clone name: TUS-38-C8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181890 is on microarray TOM1 spot ID 1-1-1.3.10.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6467 [cLEC-35-I17] Trace: SGN-T30781 EST: SGN-E210433 Direction: 5' Facility: TIGR
Clone: SGN-C181890 [TUS-38-C8] Trace: SGN-T194566 EST: SGN-E393240 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393457Length: 533 bp (889 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393457 [] (trimmed) AACTCAATCCTAGAAACTTTTATTCATGAGAAAAATATAACAACTTAAAGTAATCTTACACACAAAGGAATGCATACTATACACTCCTCTCTTAT
TTGCACAAAAGGAAATATAACAAAACAAACTCAATACTTTTAATTTTTAGTAGCAGATATGAGATCCCTAATGGCATCAAATAAGACTGCAGCCT
TAGATGGCTCAAACAACTCAATAACATGGTAACCATCTCCAAAGAGCTTGAAAGTTTTTACACCTTTCTTTTCAATAAAATCAGCAAAGTTGCGC
GAGGCATCGATTAAAGGATCTTCAGAGACACCGGTGACAAGGATCCCCCAGCCTCGTGTGATCATATCATCTAAATGCTTTGACCCTCCGTTAAG
TAATGGGTTGGAATATTCATGATCATGATCTAGTGTTCCTTTTGGTAAGGACAAGTCAAACATCTTATCAATTGCTTGAAATGGCAGAGTTGGAT
CATCTTTTAGCTTCTCTTCAGATTCTGTCCTATTTTTTCCACTGAAATATGGTTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393457] SGN-U578033 Tomato 200607 Build 2 77 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194783 [Download][View] Facility Assigned ID: FA0AAD26BB04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0043 Quality Trim Threshold: 20.5