EST details — SGN-E393542

Search information 
Request: 393542Match: SGN-E393542
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182366Clone name: TUS-39-G4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182366 is on microarray TOM1 spot ID 1-1-5.3.8.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10804 [cLEC-6-F13] Trace: SGN-T23991 EST: SGN-E202330 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393542Length: 459 bp (881 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E393542 [] (trimmed) CAGAAAACTATAATTACATTAAAGCATCATCAGTTTCAGCTTTATCGCCAACATAAATATATATACGTATATTAACTTATGAACCCCTTAACTGA
ACTTATTGACGACTTAGTAGTAAGGAATGAGCCATGTAAATGCTTGTCACACTAAAGTTGTGTGTTATGCTTTAAACACTTAATCCCGGCTCTGC
CCTGCTCATGTGGCACTTCATATGGATATATTACTACTACTTACTTTGAACTTTTTAAAGATGTCTTGTTACATAAACAAAGAGTAATTTTATAT
CACTCTAATCATATAATCCATCCACATACCCCACGTCAGTAAACCTCAACCATGATCCGCCCTGAATCAGCTTACCCACAGTGAATGACGTAGCT
TCAACGGGGTCAGTAATGACTTGATAGCCAGGCCACTTGACACGCTTACTAATACCAACACCAGATCCATTATTCATAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393542] SGN-U563073 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194868 [Download][View] Facility Assigned ID: FA0AAD27BD02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5