EST details — SGN-E393589

Search information 
Request: 393589Match: SGN-E393589
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183431Clone name: TUS-42-C13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183431 is on microarray TOM1 spot ID 1-1-4.3.1.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C68551 [cLEN-6-N8] Trace: SGN-T88389 EST: SGN-E273693 Direction: 5' Facility: TIGR
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T194915 EST: SGN-E399133 Direction: 3' Facility: INRA
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T194916 EST: SGN-E393590 Direction: 3' Facility: INRA
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T194917 EST: SGN-E393591 Direction: 5' Facility: INRA
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T199568 EST: SGN-E398242 Direction: 5' Facility: INRA
Clone: SGN-C183431 [TUS-42-C13] Trace: SGN-T199568 EST: SGN-E399554 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393589Length: 350 bp (873 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393589 [] (trimmed) AAAACATGTAAATGGTTTTACTGTGGCCTATTGTTTTTTCACCTTTCCCAATTATAAATATCCACTGCCTCAACTGAGTAAACAACCAAAATTTG
TGTTCTATAAAAAGTTTTCATATTTAGTGATCACTAAAAAAAAATCAAGAAGATGTCGACTACTGTAGGCCAAGTCATTCGTTGCAAAGCTGCTG
TGGCATGGGAAGCTGGTAAGCCATTAGTGATGGAGGAAGTAGATGTTGCTCCTCCACAGAAAATGGAAGTCCGTCTTAAGATCCTCTATACTTCA
CTCTGTCATACTGATGTATACTTCTGGGAAGCTAAGGGTCAAAATACCATCTTTCCTCGAATTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393589] SGN-U579420 Tomato 200607 Build 2 345 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194915 [Download][View] Facility Assigned ID: FA0AAD30AB07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5