EST details — SGN-E393628
| Search information |
| Request: 393628 | Match: SGN-E393628 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183627 | Clone name: TUS-42-K17 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183627 is on microarray TOM1 spot ID 1-1-8.3.1.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C32358 [cLEG-1-A15] | Trace: SGN-T64359 | EST: SGN-E248296 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183627 [TUS-42-K17] | Trace: SGN-T195962 | EST: SGN-E394636 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183627 [TUS-42-K17] | Trace: SGN-T195962 | EST: SGN-E399179 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183627 [TUS-42-K17] | Trace: SGN-T199408 | EST: SGN-E399178 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183627 [TUS-42-K17] | Trace: SGN-T199571 | EST: SGN-E398245 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E393628 | Length: 84 bp (925 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E393628 [] (trimmed - flagged)
GAAGATGCAGGGTTCTTTAATGCCTTGGCCTGGTGATGAAGGTCCAAAGCGGAGGGAACAAGCATGGATGGCCATAAAAAAGGT
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T194954 [Download][View] | Facility Assigned ID: FA0AAD30AF09RM2 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Possibly chimeric (anomalous insert into vector) |
| Sequence Entropy: 0.891 | Expected Error Rate: 0.0311 | Quality Trim Threshold: 14.5 |
Working
