Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E393634

Search information 
Request: 393634Match: SGN-E393634
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183671Clone name: TUS-42-M13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183671 is on microarray TOM1 spot ID 1-1-4.1.1.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183671 [TUS-42-M13] Trace: SGN-T195499 EST: SGN-E394173 Direction: 5' Facility: INRA
Clone: SGN-C183671 [TUS-42-M13] Trace: SGN-T195499 EST: SGN-E399190 Direction: 5' Facility: INRA
Clone: SGN-C183671 [TUS-42-M13] Trace: SGN-T199409 EST: SGN-E398083 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393634Length: 472 bp (854 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393634 [] (trimmed) CCAAAATTGCCCACTTCTTGTCCATTGTACAAAGGGCAGTCTTTTTCTAGATCTACTGCCCCCTCTCTCTCTCTGTGATTCCTTCTTCATCACCG
CATTGAAGAAAGATGGGTTTATCATTCCGGAAGCTTTTCAGCCGGCTGTTTGCCAAGAAGGAGATGCGTATTCTGATGGTTGGTCTTGATGCAGC
TGGTAAAACCACCATATTGTACAAGCTCAAGCTGGGAGAGATTGTTACCACCATTCCTACCATTGGATTCCATGTGGAGACTGTTGAATACAAGA
ACATAAGCTTCACCGTCTGGGATGTCGGGGGTCAGGACAAGATCAGACCATTGTGGAGGCATTACTTCCAAAACACACAAGGACTTATCTTTGTG
GTTGATAGTAATGATCGAGATCGTGTTGATGAGGCCAAAGACCACCTGCATCGGATGTTGAATGACGATGAACTGACAGATGCTGTGCAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393634] SGN-U577814 Tomato 200607 Build 2 189 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194960 [Download][View] Facility Assigned ID: FA0AAD30AG07RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0210 Quality Trim Threshold: 14.5