EST details — SGN-E393662

Search information 
Request: 393662Match: SGN-E393662
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183588Clone name: TUS-42-J2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183588 is on microarray TOM1 spot ID 1-1-7.2.2.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183588 [TUS-42-J2] Trace: SGN-T194988 EST: SGN-E399471 Direction: 3' Facility: INRA
Clone: SGN-C183588 [TUS-42-J2] Trace: SGN-T194989 EST: SGN-E393663 Direction: 5' Facility: INRA
Clone: SGN-C183588 [TUS-42-J2] Trace: SGN-T195534 EST: SGN-E394208 Direction: 3' Facility: INRA
Clone: SGN-C183588 [TUS-42-J2] Trace: SGN-T199649 EST: SGN-E398323 Direction: 5' Facility: INRA
Clone: SGN-C183588 [TUS-42-J2] Trace: SGN-T199649 EST: SGN-E399472 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393662Length: 583 bp (819 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393662 [] (trimmed) TCAAATAGCAGCTCTAGTAGCTCCCGTGATGAAGAGGAAGAAATTGGAGAGGATGGACTGAAGATCATGAAGAAGAAAAAGAAGGGATTGAAGGA
TAATATTAACACAAAAATATCTGGTGATCACAAGGAAGAATCAAAAGCAGAGGATACCTCTGTTCCAGTTGAGAAATACGAGGAAACAGAGGAGA
CACAAGGATTTCTAGACAAAATTAAGGAGAAATTGCCAGGTGGCGGGCATAATAAGACCGAGGAAGTGGCGGCCCCACCACCACCACCACCGGCT
GCGGTGGAGCATGACGCGGAGGGGAAGGAGAAGAAGGGATTTTTGGACAAAATTAAGGAGAAATTACCAGGATACCACTCGAAGGCTGAAGAGGA
AAAGGAGAAGGAAGAAGCACTAACTGAAATGAAATGTTTTTTTAATTTTACTTTTGGGATGTTATGATTGTGTTGCTGTGTTGTTTTGGTTTTTA
AATGTTTTTCATTTCCTTCACTTTTGTTTTTTTTGCGATTCTGAAGGATAATTGTTAGTACTGTATTTGATATTTCTGTATGTAAGTGCATATGT
ATGTGCCTTCTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393662] SGN-U581375 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194988 [Download][View] Facility Assigned ID: FA0AAD30DE01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0341 Quality Trim Threshold: 12.5