EST details — SGN-E393728

Search information 
Request: 393728Match: SGN-E393728
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183634Clone name: TUS-42-K24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183634 is on microarray TOM1 spot ID 1-1-1.3.1.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C68594 [cLEN-7-B19] Trace: SGN-T88463 EST: SGN-E273767 Direction: 5' Facility: TIGR
Clone: SGN-C183634 [TUS-42-K24] Trace: SGN-T196146 EST: SGN-E394820 Direction: 5' Facility: INRA
Clone: SGN-C183634 [TUS-42-K24] Trace: SGN-T196146 EST: SGN-E399302 Direction: 5' Facility: INRA
Clone: SGN-C183634 [TUS-42-K24] Trace: SGN-T200318 EST: SGN-E399301 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393728Length: 231 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393728 [] (trimmed) TTCAGGAAAACCATTGGGAGAATAATGAGCGCCCAACACTCCATACCCGATTATGTACGAGTCACACCATATTTCAGGAACCTCCTTTCGCGAAT
CTTTGTTGCAAATCCCTCGGAGAGGATAACTATTCCTGAGATAAAGAAACATCCTTGGTTCTTAAAGAATCGACCAAAAGAGCTGATGGATGTTG
AGGCCGCTGAGATTCGAAGAGGCTTCGCAGGCTGCTACACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393728] SGN-U586078 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195054 [Download][View] Facility Assigned ID: FA0AAD30BF12RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0177 Quality Trim Threshold: 14.5