EST details — SGN-E393742

Search information 
Request: 393742Match: SGN-E393742
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183395Clone name: TUS-42-B1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183395 is on microarray TOM1 spot ID 1-1-8.2.2.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2660 [cLEC-16-L21] Trace: SGN-T26923 EST: SGN-E205034 Direction: 5' Facility: TIGR
Clone: SGN-C183395 [TUS-42-B1] Trace: SGN-T195068 EST: SGN-E399330 Direction: 3' Facility: INRA
Clone: SGN-C183395 [TUS-42-B1] Trace: SGN-T200337 EST: SGN-E399331 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393742Length: 375 bp (831 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393742 [] (trimmed) AATTGCAATATATAAAAAGTAAACCAACATAAATGTGTAGCAACACACTTATTCTACCCTCCCTTCATTTGTACAGCTATTCTTACAAAAGCCTT
TTGGTACAGTTTACAACATGATTCGGGATTGATTTGTGTTTGTTACCAACTACATATAAAAGTTTTTGTATCAATACTTAAATCTTTTCTTAAAA
AAAAAAATTTCATATATCTGCTCCAATGGAAAAACAATAACAACAACCTACTGGACAAAACTTAAATTGATGGTGATCTTTTCTAGCTATGGAAC
TCAAACCAAATGAAAAAACCTTGCAAGCTTTTTTTTATTAAAAAAAAAGAACCAACGCCTCGGGGGGGGGGAGCAAAAAACCCTAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393742] SGN-U581827 Tomato 200607 Build 2 94 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195068 [Download][View] Facility Assigned ID: FA0AAD30CA01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.877 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5