EST details — SGN-E393746

Search information 
Request: 393746Match: SGN-E393746
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183413Clone name: TUS-42-B19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183413 is on microarray TOM1 spot ID 1-1-6.2.1.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32398 [cLEG-1-E7] Trace: SGN-T64425 EST: SGN-E248362 Direction: 5' Facility: TIGR
Clone: SGN-C183413 [TUS-42-B19] Trace: SGN-T195072 EST: SGN-E399341 Direction: 3' Facility: INRA
Clone: SGN-C183413 [TUS-42-B19] Trace: SGN-T196067 EST: SGN-E394741 Direction: 5' Facility: INRA
Clone: SGN-C183413 [TUS-42-B19] Trace: SGN-T200339 EST: SGN-E399342 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393746Length: 379 bp (843 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393746 [] (trimmed) GATGAGATAATATGGTACAAAGAAAATAAACAAGGAGAGAAACACTAACAAAAGAATAATAAATCCCGTTTTTCTCACAGTAAATAACCATGACA
CATTAAAAAAAAAGAAGAAGATAAAGATGCAAATTTTTAGACGTATACGATGATTAAACCACCTTTGGTGCTTCTTCCACCTTAGTTGCAGGTGC
CACGTCAGCAACAACAGTAGCAGGTGCTTCTTCCTTGTTTGGTTCTCCAGACTCAATAACTATCTCCTTCTCCTTCTCCTTCACCTTCACCTCCA
CTTTTTTTTTTGACGTGGCGGCTGGTGCATGCACGTCATCAGCAGCCGCGGGTTCCTCTTCCTTCTTATCTTCTGTGACTATGAAAGTGGAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393746] SGN-U580472 Tomato 200607 Build 2 105 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195072 [Download][View] Facility Assigned ID: FA0AAD30CA10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0244 Quality Trim Threshold: 14.5