EST details — SGN-E393778

Search information 
Request: 393778Match: SGN-E393778
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172683Clone name: TUS-14-C17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172683 is on microarray TOM1 spot ID 1-1-8.3.20.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10800 [cLEC-6-F1] Trace: SGN-T24164 EST: SGN-E202503 Direction: 5' Facility: TIGR
Clone: SGN-C172683 [TUS-14-C17] Trace: SGN-T195739 EST: SGN-E394413 Direction: 3' Facility: INRA
Clone: SGN-C172683 [TUS-14-C17] Trace: SGN-T195739 EST: SGN-E398910 Direction: 3' Facility: INRA
Clone: SGN-C172683 [TUS-14-C17] Trace: SGN-T199581 EST: SGN-E398255 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393778Length: 195 bp (872 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393778 [] (trimmed) AAAAGTCATATGGATATAGCAATGCATTAACAAGCCACTCCACAAACCTTCATTGACAGTTGTGAAATTGTTGAAACAATTTTCACTATCAGTAT
TTAGATTTCTATATTTTACAAGACTGTGGTATATACAGCCTTGTATTTTTTTTTTCATGCAGCACTTTTTTCGATTTTTATGTCATATAGAATTT
CGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393778] SGN-U569454 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195104 [Download][View] Facility Assigned ID: FA0AAD2AB09FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.867 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5