EST details — SGN-E393778
Search information |
Request: 393778 | Match: SGN-E393778 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C172683 | Clone name: TUS-14-C17 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172683 is on microarray TOM1 spot ID 1-1-8.3.20.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C10800 [cLEC-6-F1] | Trace: SGN-T24164 | EST: SGN-E202503 | Direction: 5' | Facility: TIGR |
Clone: SGN-C172683 [TUS-14-C17] | Trace: SGN-T195739 | EST: SGN-E394413 | Direction: 3' | Facility: INRA |
Clone: SGN-C172683 [TUS-14-C17] | Trace: SGN-T195739 | EST: SGN-E398910 | Direction: 3' | Facility: INRA |
Clone: SGN-C172683 [TUS-14-C17] | Trace: SGN-T199581 | EST: SGN-E398255 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E393778 | Length: 195 bp (872 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E393778 [] (trimmed)
AAAAGTCATATGGATATAGCAATGCATTAACAAGCCACTCCACAAACCTTCATTGACAGTTGTGAAATTGTTGAAACAATTTTCACTATCAGTAT
TTAGATTTCTATATTTTACAAGACTGTGGTATATACAGCCTTGTATTTTTTTTTTCATGCAGCACTTTTTTCGATTTTTATGTCATATAGAATTT
CGGGA
TTAGATTTCTATATTTTACAAGACTGTGGTATATACAGCCTTGTATTTTTTTTTTCATGCAGCACTTTTTTCGATTTTTATGTCATATAGAATTT
CGGGA
Unigenes |
Current Unigene builds | |||||
[SGN-E393778] | SGN-U569454 | Tomato 200607 | Build 2 | 16 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T195104 [Download][View] | Facility Assigned ID: FA0AAD2AB09FM2 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.867 | Expected Error Rate: 0.0070 | Quality Trim Threshold: 14.5 |