EST details — SGN-E393802

Search information 
Request: 393802Match: SGN-E393802
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172829Clone name: TUS-14-I19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172829 is on microarray TOM1 spot ID 1-1-6.1.20.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C11011 [cLEC-6-O18] Trace: SGN-T23981 EST: SGN-E202320 Direction: 5' Facility: TIGR
Clone: SGN-C172829 [TUS-14-I19] Trace: SGN-T195314 EST: SGN-E393988 Direction: 3' Facility: INRA
Clone: SGN-C172829 [TUS-14-I19] Trace: SGN-T195314 EST: SGN-E398951 Direction: 3' Facility: INRA
Clone: SGN-C172829 [TUS-14-I19] Trace: SGN-T195315 EST: SGN-E393989 Direction: 5' Facility: INRA
Clone: SGN-C172829 [TUS-14-I19] Trace: SGN-T200442 EST: SGN-E399524 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393802Length: 527 bp (828 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393802 [] (trimmed) AAATTTGGGAAGTCCCACTTACTAAACATATTTATTGAACAAAAACAAAGTGCAAGGTATTGTCAAAATACCAAATCATTATTGTACTACCATAC
CATAATAATTAATTAAAATTTAACACAATATAATCATTGATAACACTAAAACTTTCTGCAAGGGGGCAACGGTGAACCACAAAGTCCTTTATTTC
CAGCAAATGAATTACCCTTAAACTTTGTTGGTGGAAGTTGACCACTCAAATGATTATTACTCAAATTCAACTTGTTTAGTCCACTAATTTCCTTT
GAAACTTCCCCATAAACCATATTTCTAAACAAATCCAATTCCTTAATTGTCTTAACAATCTTCATTTTCTCCAAATCAAACTTTAATTTATTCCC
ACCACCATAAAATCCAATTAAAAAATCAGTCTTATTCAACAGCCCAATCGGACTTCCAGTAGGGGCGGGAGCCGATAAATCAATATACTCGTAAA
AATACGTTGTTTTTGGGTTCCAATCATCCAATTTGATCTTGATCCCCCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393802] SGN-U575404 Tomato 200607 Build 2 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195128 [Download][View] Facility Assigned ID: FA0AAD2AE10FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0129 Quality Trim Threshold: 14.5