EST details — SGN-E393838

Search information 
Request: 393838Match: SGN-E393838
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183019Clone name: TUS-41-B9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183019 is on microarray TOM1 spot ID 1-1-8.2.3.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67212 [cLEN-17-N16] Trace: SGN-T90905 EST: SGN-E276484 Direction: 5' Facility: TIGR
Clone: SGN-C183019 [TUS-41-B9] Trace: SGN-T195808 EST: SGN-E394482 Direction: 3' Facility: INRA
Clone: SGN-C183019 [TUS-41-B9] Trace: SGN-T195808 EST: SGN-E398838 Direction: 3' Facility: INRA
Clone: SGN-C183019 [TUS-41-B9] Trace: SGN-T200139 EST: SGN-E398839 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393838Length: 269 bp (921 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393838 [] (trimmed) CGAAAAATCATTTTTTAGAAATCCATTTTTCATATATATAATTTTTTTAAAATGAGTCTATTTGGTCTTGGAAGGAATCAGAGAACATTCCGTCC
CAAAAAGAGTGCACCCTCAGGGAGTAAGGGTGCACAATTAAGACAGCACATTGATTCTACTTTAGGCAGCGGAAACTTGAGAGAGGCTGTAAGGC
TTCCTCCTGGGGAAGATATTAATGAATGGCTAGCTGTCAGCACTGTATATTTCTTCGGAGAGGGGAATCTACGTGATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393838] SGN-U580589 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195164 [Download][View] Facility Assigned ID: FA0AAD29CA05RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5