EST details — SGN-E393974

Search information 
Request: 393974Match: SGN-E393974
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172721Clone name: TUS-14-E7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172721 is on microarray TOM1 spot ID 1-1-2.1.20.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172721 [TUS-14-E7] Trace: SGN-T195110 EST: SGN-E393784 Direction: 3' Facility: INRA
Clone: SGN-C172721 [TUS-14-E7] Trace: SGN-T199582 EST: SGN-E398256 Direction: 5' Facility: INRA
Clone: SGN-C172721 [TUS-14-E7] Trace: SGN-T199582 EST: SGN-E398920 Direction: 5' Facility: INRA
Clone: SGN-C172721 [TUS-14-E7] Trace: SGN-T199610 EST: SGN-E398284 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393974Length: 152 bp (933 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393974 [] (trimmed) GCACGAGGACTTTTGCCAACTAAAAGGAACAAAAGAATGAAGCAAATTTTCAATGAAGTAAGAACACTGATACTAGAAATTATCACCAAAAGATT
GAGGATGATTGATCCGAGTACGGCGGTGCTCGGTGTCAGTCATCCACACCGTACTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393974] SGN-U592675 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195300 [Download][View] Facility Assigned ID: FA0AAD2AC04RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.844 Expected Error Rate: 0.0182 Quality Trim Threshold: 14.5